Associated material
Related literature
Other articles by authors
Related articles/pages
Download to ...
Share this article
Your browser does not support iframes
Email updates
Research article
The Theobroma cacao B3 domain transcription factor TcLEC2 plays a duel role in control of embryo development and maturation
Yufan Zhang, Adam Clemens, Siela N Maximova and Mark J Guiltinan*
Corresponding author:
Mark J Guiltinan
The Huck Institute of the Life Sciences, The Pennsylvania State University, 422 Life Sciences Building, University Park, PA 16802, USA
The Department of Plant Science, The Pennsylvania State University, University Park, PA 16802, USA
For all author emails, please .
BMC Plant Biology 2014, 14:106&
doi:10.29-14-106
The electronic version of this article is the complete one and can be found online at:
Received:27 January 2014
Accepted:7 April 2014
Published:24 April 2014
& 2014 Zhang et al.; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Background
The Arabidopsis thaliana LEC2 gene encodes a B3 domain transcription factor, which plays critical roles during
both zygotic and somatic embryogenesis. LEC2 exerts significant impacts on determining
embryogenic potential and various metabolic processes through a complicated genetic
regulatory network.
An ortholog of the Arabidopsis Leafy Cotyledon 2 gene (AtLEC2) was characterized in Theobroma cacao (TcLEC2). TcLEC2 encodes a B3 domain transcription factor preferentially expressed during early and
late zygotic embryo development. The expression of TcLEC2 was higher in dedifferentiated cells competent for somatic embryogenesis (embryogenic
calli), compared to non-embryogenic calli. Transient overexpression of TcLEC2 in immature zygotic embryos resulted in changes in gene expression profiles and fatty
acid composition. Ectopic expression of TcLEC2 in cacao leaves changed the expression levels of several seed related genes. The
overexpression of TcLEC2 in cacao explants greatly increased the frequency of regeneration of stably transformed
somatic embryos. TcLEC2 overexpressing cotyledon explants exhibited a very high level of embryogenic competency
and when cultured on hormone free medium, exhibited an iterative embryogenic chain-reaction.
Conclusions
Our study revealed essential roles of TcLEC2 during both zygotic and somatic embryo
development. Collectively, our evidence supports the conclusion that TcLEC2 is a functional ortholog of AtLEC2 and that it is involved in similar genetic regulatory networks during cacao somatic
embryogenesis. To our knowledge, this is the first detailed report of the functional
analysis of a LEC2 ortholog in a species other then Arabidopsis. TcLEC2 could potentially be used as a biomarker for the improvement of the SE process and
screen for elite varieties in cacao germplasm.
Keywords: LEC2; Cacao zygoti Cacao s E Fatty acid biosynthesisBackground
The tropical tree Theobroma cacao L. is cultivated as a cash crop in many developing countries and provides the main
ingredients for chocolate production. In 2011, the global market value of the chocolate
industry surpassed $100 billion and the demand for cacao beans (seeds) continues to
increase []. Cacao trees are generally highly heterozygous and when propagated by seed, only
a small fraction of individuals are high producing [-]. Thus, vegetative propagation systems provide a means to avoid the issue of trait
variation, through cloning of the top elite individual genotypes.
Several methods of vegetative propagation are commonly used with cocoa (grafting and
rooted cuttings techniques). In addition, in vitro somatic embryogenesis (SE) tissue culture offers an approach to speed up the development
and deployment of genetically improved genotypes because of its potentially very high
multiplication rate and scalability. Protocols for primary and secondary SE in cacao
have been well documented [-]. However, SE can be limited by embryogenic efficiency, which varies significantly
between genotypes. A deeper understanding of the genes and mechanisms involved in
regulating the SE process in cacao could potentially lead to improvement of SE methods
for commercial plant production. To characterize the mechanisms regulating embryogenesis,
we have chosen a translational biology approach, leveraging the knowledge gained from
the model plant Arabidopsis.
In Arabidopsis, leafy cotyledon (LEC) transcription factors, including AtLEC1 [], AtLEC2 [] and AtFUS3 [] have been characterized as master regulators of zygotic embryo development []. The AtLEC2 gene encodes a B3 domain transcription factor, which binds specifically to the RY motifs in the 5′ flanking regions of AtLEC2-induced genes []. AtLEC2 is exclusively expressed in developing zygotic embryos during both the early development
and maturation phases. It is required for development and maintenance of suspensors
and cotyledons and for the acquisition of desiccation tolerance and inhibition of
premature germination []. Loss-of-function Arabidopsis lec2 mutants exhibit pleiotropic effects including abnormal suspensor anatomy, abnormal
cotyledons with trichomes, precociously activated shoot apical meristems, highly pigmented
cotyledon tips with prominent anthocyanin accumulation and reduced accumulation of
seed storage compounds [,,]. AtLEC2 functions both by inducing a cascade effect of other transcription factors
controlling various developmental and metabolic pathways as well as through direct
targeting and regulation of seed storage genes [,]. For example, AtWRI1, another key transcription factor crucial to embryo development, is a direct target
of AtLEC2 and is necessary to regulate normal fatty acid biosynthesis [].
LEC genes are also important during somatic embryogenesis. For example, lec2 mutants produced SEs in Arabidopsis at a very low efficiency [], while ectopic expression of AtLEC2 in Arabidopsis and tobacco vegetative tissue induced SE formations [,,]. In addition, the capacity for SE was abolished in double (lec1 lec2, lec1 fus3, lec2 fus3) or triple (fus3 lec1 lec2) LEC mutants, which further confirms the critical and redundant roles of LEC proteins
during SE []. It is well known that exogenous application of hormones, such as synthetic auxin
(2,4-D) and cytokinin, are required to induce SE [-] and furthermore, a functional interaction between auxin and AtLEC2 has been observed. In Arabidopsis, the expression of AtLEC2 was significantly up-regulated in response to exogenously applied 2,4-D during the
induction phase of SE []. Also, expression levels of AtLEC2 were observed to be significantly higher in embryogenic callus compared to the non-embryogenic
callus of the same age []. Interestingly, overexpression of AtLEC2 in immature zygotic embryo transgenic explants was able to induce direct somatic
embryogenesis, with little callus formation and in the absence of exogenous auxin
[]. Regarding this, Stone and Wojcikowska proposed that AtLEC2 may activate genes involved in auxin biosynthesis, such as YUC1, YUC2, YUC4 and YUC10 [,]. Taken together, AtLEC2 is essential for maintaining embryogenic competency of plant somatic cells through
complex interactions with transcriptional regulators and auxin [].
The LEC genes are also involved in regulation of fatty acid biosynthesis and storage lipid
deposition during embryo development. The seed specific overexpression of ZmLEC1 and BnLEC1 led to 35% and 20% increase in seed oil contents in maize and canola, respectively
[,]. Ectopic expression of AtLEC2 in Arabidopsis leaves resulted in the accumulation of seed specific fatty acids (C20:0
and C20:1) and increased the mRNA level of oleosin []. Furthermore, a direct downstream target of AtLEC2, AtWRI1 is known to control fatty acid metabolism through interactions with key genes upstream
in the pathway [].
Although the functions of AtLEC2 have been extensively studied in Arabidopsis, and homologs described in several plant
species [], a functional ortholog has not been characterized in any other plants to date. We
present here the identification of a putative ortholog of AtLEC2 in cacao, TcLEC2. We characterized the expression patterns of TcLEC2 during both zygotic and somatic embryogenesis and explored the relationships between
the activity of TcLEC2 in modulating the embryogenic potential of callus and in regulation
of the fatty acid biosynthesis pathway.
Gene isolation and sequence comparison
The Arabidopsis AtLEC2 gene (At1G28300) is part of a large family of B3 domain containing proteins involved
in a wide variety of functions. In the Arabidopsis genome, 87 genes were previously
annotated as B3 domain containing genes that were further classified into five different
families: auxin response factor (ARF), abscisic acid-insensitive3 (ABI3) of which
AtLEC2 is a member, high level expression of sugar inducible (HSI), related to ABI3/VP1
(RAV) and reproductive meristem (REM) [].
In order to identify a putative ortholog of AtLEC2 in cacao, the full-length amino acid sequence of Arabidopsis AtLEC2 was blasted against the predicted proteome of the Belizean Criollo genotype (B97-61/B2)
( &[]) using blastp algorithm with E-value cut-off of 1e-5 [], which resulted in identification of 13 possible candidate genes (Additional file
). As a second approach to identify cacao LEC2 gene (s), the predicted protein sequences of each of the 13 candidate genes were
used to search the predicted proteome from a second sequenced cacao genome of cv.
Matina 1–6 v1.1 ( &[]) by Blastp and a set of nearly identical cognate genes were identified for each (Additional
file ). No additional related genes were identified in this variety of cacao. Of the 13
candidate genes, the gene Tc06g015590 resulted in the best alignment with AtLEC2, resulting in a blastp expect value of 3E-75.
Additional file 1. Correspondent gene comparison from Criollo and Forastero genome database.
Format: PDF
Size: 39KB This file can be viewed with:
To identify the most likely AtLEC2-orthologous gene, a phylogenetic analysis was performed with the 13 candidate cacao
genes and several representative genes from each of the five B3 domain families in
Arabidopsis (Figure&A). The 13 cacao genes clustered with three of the B3 domain containing gene families
(HIS, ABI3, RAV). Three cacao genes clustered within the ABI3 subfamily, with one
cacao gene pairing with each of the three Arabidopsis members of this group (Tc04g004970 with AtFUS3, Tc01g024700 with AtABI3 and Tc06g015590 with AtLEC2), again suggesting that Tc06g015590 is the most likely ortholog of AtLEC2 in the cacao genome. This gene exists as a single copy and we tentatively designated
it as TcLEC2.
Phylogenetic analysis and gene structure of B3 domain containing genes in cacao. A. Unrooted neighbor-joining consensus tree of full-length amino acid sequences of
selected Arabidopsis and Theobroma cacao B3 domain containing genes. The scale bar represents 0.2 estimated substitutions
per residue and values next to nodes indicate bootstrap values from 1000 replicates.
Five families of B3 domain containing genes were identified. The gene most closely
related to AtLEC2 (underlined) was designated as TcLEC2. B. Comparison of TcLEC2 and AtLEC2 gene structures. Boxes represent exons and lines indicate introns. Location of the
conserved B3 domain is indicated. C. Amino acid alignment of B3 domains from TcLEC2, AtLEC2, AtFUS3, and AtABI3. Residues in black boxes are identical
residues in dark grey
boxes are identical in th residues in light grey boxes are identical
in two of four proteins.
The annotation of TcLEC2 (Tc06g015590) in the cacao genome database predicted two translational start sites 72&bp apart.
PCR primers were designed based on the most 5′ potential translation start site and
a predicted full-length coding sequence of TcLEC2 was amplified from cDNA extracted from SCA6 mature zygotic cotyledons. A 1368&bp fragment was sequenced and after alignment with
the TcLEC2 genomic sequence, a gene model was constructed, consisting of six exons and five
introns, nearly identical to the AtLEC2 gene structure (Figure&B). The lengths of the first and last exons differ slightly and the remaining four
are identical. The TcLEC2 encodes an open reading frame of 455 amino acid residues with the B3 domain predicted
in the central region of the polypeptide. The full-length TcLEC2 protein shares 42%
identity with AtLEC2 (Additional file ); however, they are 81% identical within the B3 domain (Figure&C).
Additional file 2. Full-length amino acid alignment of TcLEC2, AtLEC2, AtFUS3, and AtABI3. Residues in black boxes are identical
residues in dark grey
boxes are identical in th residues in light grey boxes are identical
in two of four proteins.
Format: PDF
Size: 160KB This file can be viewed with:
TcLEC2 is expressed primarily in endosperm and early mature embryo cotyledons
To investigate the function of TcLEC2 in cacao, its expression was measured by qRT-PCR
in various tissues including: leaves at developmental stages A, C, and E (defined
in []), unopened flowers, open flowers, roots, endosperm and zygotic seeds at 14, 16, 18,
20&weeks after pollination (WAP). A cacao beta-tubulin gene (TcTUB1, Tc06g000360) that was previously shown to exhibit stable expression levels during cacao seed
development (unpublished data) was used for normalization. TcLEC2 was exclusively expressed in cacao endosperm and cotyledon (Figure&), and significant levels of transcript were not detected in other tissues, consistent
with the AtLEC2 expression pattern in Arabidopsis [,]. Moreover, the expression of TcLEC2 was significantly higher in cacao cotyledons at 14 and 18 WAP compared to 16 and
20 WAP, stages previously defined as the onsets of cacao embryo morphogenesis and
the seed maturation phase, respectively []. A similar biphasic expression pattern was reported for LEC2 in Arabidopsis [], suggesting a potential role of TcLEC2 in early developmental induction and in maturation
phases of zygotic embryogenesis. Notably, the transcript of TcLEC2 was accumulated to high levels in endosperm (90&days after pollination) when the
embryo had just begun development (Figure&). The endosperm functions to provide nutritive support to the developing embryo,
and for crosstalk between maternal tissue and the embryo, being a critical determinant
of successful embryo development []. Therefore, the abundance of TcLEC2 transcript in the endosperm of developing cacao ovules suggests that TcLEC2 expression in endosperm could be involved in controlling embryo initiation in cacao.
TcLEC2 expression pattern in different cacao tissues. Tissues include: leaves and flowers at different developmental stages, roots and
zygotic cotyledons from seeds collected at 14, 16, 18 and 20&weeks after pollination
(14&W Cot, 16&W Cot, 18&W Cot and to 20&W Cot respectively). The expression levels
were analyzed by qRT-PCR and TcLEC2 gene normalized relative to that of TcTUB1 gene. Bars represent mean values (n = 3; mean ± SE). Significance was established
by t-test (**represents p-value & 0.01by t- *represents p-value & 0.05 by t-test).
Ectopic expression of TcLEC2 was sufficient to activate seed specific gene expression in cacao leaves
To test the function of cacao TcLEC2 in regulation of gene expression and to identify
its putative downstream targets, a rapid transient transformation assay using cacao
leaf tissue was utilized [] (see Methods, Additional file ). TcLEC2 was ectopically overexpressed under the E12-Ω modified CaMV35S promoter (E12Ω::TcLEC2, pGZ12.0108, GenBank Accession: KF963132, Additional file ) in fully expanded young stage C cacao leaves using Agrobacterium vacuum infiltration. Agrobacterium containing empty based vector pGH00.0126 (control vector, GenBank Accession: KF018690,
EGFP only) was also infiltrated in parallel as a control. As expected, TcLEC2 was highly expressed only in leaves transformed with E12Ω::TcLEC2 vector but was
not detectable in control leaves (Figure&). To identify the potential targets of TcLEC2, a set of cacao putative orthologs
of genes involved in seed development in Arabidopsis was also assayed via qRT-PCR
(Table&). The predicted ortholog of AGAMOUS-Like 15, a MADS box type transcription factor involved in the induction of somatic embryogenesis
from shoot apical meristems [], was highly induced (&129 fold) by TcLEC2 ectopic overexpression (Figure&), which was consistent with the observation that LEC2 and AGL15 were able to activate
each other in Arabidopsis []. The predicted ortholog of ABA INSENSITIVE 3 (ABI3), which encodes a B3 domain transcription factor active during seed development and
previously identified as a downstream target of AtLEC2 in Arabidopsis [,], was also induced (&9 fold) by TcLEC2 (Figure&). However, another B3 domain transcription factor FUSCA 3 (FUS3) [,] was not responsive to TcLEC2 overexpression in leaf tissues under our experimental conditions (Table&). The predicted ortholog of WRINKLED 1 (WRI1), an AP2/EREB family transcription factor that is the direct downstream target of
AtLEC2 and specifies AtLEC2 function toward fatty acid biosynthesis pathway in Arabidopsis
[,], was induced more than ten-fold by TcLEC2 (Figure&). Moreover, two genes encoding for OLEOSIN proteins, involved in the structure of oil bodies, were also activated in cacao leaves
by TcLEC2 ectopic overexpression (Figure&). Collectively, these results indicated that TcLEC2 was sufficient to induce the
ectopic transcription of several important seed specific genes in cacao leaves, supporting
its function as a key regulator of embryo and seed development.
Additional file 3. Ectopic overexpression of control vector (pGH00.0126) and E12Ω::TcLEC2 in cacao attached
leaf transient assay. Fluorescent micrographs of GFP expression (visualization marker) in leaves were captured
three days after transformation (Bars = 0.4mm). A. GFP fluorescence image of cacao stage C leaves transformed with control vector.
B. GFP fluorescence image of cacao stage C leaves transformed with E12Ω::TcLEC2.
Format: PDF
Size: 3.8MB This file can be viewed with:
Additional file 4. Vector map of E12Ω::TcLEC2. Location of the TcLEC2 and GFP transgenes are indicated as are the NPTII selectable
marker genes, and the location of all plant promoter and terminator elements. The
control vector plasmid (pGH00.0126, GenBank: KF) is identical but lacks the
E12Ω-TcLEC2-35S Terminator transgene segment.
Format: PDF
Size: 7.3MB This file can be viewed with:
Genes induced by ectopic overexpression of TcLEC2 in attached cacao leaf transient assay. Expression levels of TcLEC2 and TcLEC2 induced genes (TcAGL15, TcABI3, TcWRI1, TcOLE1, and TcOLE2) in TcLEC2 ectopic expressing attached cacao leaves compared to vector control by qRT-PCR. The
expression levels of genes were normalized relative to that of TcACP1. (n = 3, mean ± SE) *represents for p-value & 0.05 by t-test.
Changes in gene expression levels in response to TcLEC2 ectopic expression in leaf tissues of genes involved in various dimensions of seed
development calculated from qRT-PCR measurements
TcLEC2 expression is associated with embryogenic competency of callus cells
Based on the above results, we reasoned that TcLEC2 might also be a key regulator
of somatic embryogenesis. To explore this, TcLEC2 was measured in tissues grown with or without the SE inducing hormone 2,4-D (Figure&). Staminodes from the highly embryogenic cacao genotype PSU-SCA6 were used to produce primary somatic embryos (Figure&A, panel i) following our previously published protocol []. Cotyledon explants (Figure&A, panel i, red box) were excised and placed on secondary embryogenesis induction
media with (SCG) or without (SCG-2,4D) auxin 2,4-D (required for SE induction). After
two weeks on these media, the tissues were transferred biweekly to hormone free embryo
development media (ED). The explants cultured on SCG media started to produce calli
two-weeks after culture initiation (ACI) (panel ii) and secondary somatic embryos
were visible after four additional weeks (panel iv and vi). However, on SCG-2,4D,
explants expanded and gradually turned green during the first six weeks, then stopped
developing and turned brown. Neither calli nor embryos were produced from the explants
on SCG-2,4D medium (panel iii, v and vii).
TcLEC2 expression correlates with embryogenic potential. A. Illustration of the cacao secondary somatic embryogenesis stages and time frame,
indicating the points used for sample collections. Representative images of several
key stages of embryo development: (i) cotyledon stage PSU-SCA6 embryo used as explants to initiate secondary somatic em (i)
& (iii) cotyledon explants on hormone-free medium at 28&days ACI, from cultures initiated
on SCG medium containing 2, 4D and modified SCG without 2, 4D, (iv)
& (v) cotyledon explants on ED at 46&days ACI (same treatments as above); (vi) & (vii)
cotyledon explants on ED at 70&days ACI (same treatments as above); (Bars = 2&mm).
B. Time course expression pattern of TcLEC2 during cacao secondary somatic embryogenesis from cultures initiated on SCG medium
containing 2,4D and modified SCG without 2, 4D. Expression of TcLEC2 was normalized relative to that of TcACP1 (n = 3 or 4, mean ± SE). C. Expression levels of TcLEC2 at different time points in embryogenic and non-embryogenic calli. Expression of
TcLEC2 was normalized relative to that of TcACP1. Bars represent mean ± SE (n = 3 or 4). Significance was established by t-test (*represents
for p-value & 0.05).
TcLEC2 expression levels were measured in tissues cultured on both SCG and SCG-2,4D media
throughout the culture period (Figure&B). TcLEC2 expression was detectable in primary somatic embryo cotyledons at time 0, then decreased
significantly one day after explants were placed on either SCG or SCG-2,4D media (Figure&B). TcLEC2 expression remained low in both treatments for the following two weeks, indicating
that TcLEC2 was not rapidly responsive to exogenous auxin treatment during the induction period.
However, between day 32 and 36 ACI, TcLEC2 expression levels were slightly increased and variable in both treatments. Notably,
at 46&days ACI the development of embryos was first observed on SCG media arising
from calli (embryogenic calli). RNA was extracted from the embryogenic calli (without
visible embryos) and a large increase in TcLEC2 gene expression was observed by qRT-PCR. On SCG-2,4D media, embryos were not observed
and TcLEC2 expression was not detectable.
A common occurrence in tissue culture is dedifferentiation of different types of calli
that vary in their totipotency to regenerate somatic embryos [,]. With cacao tissue cultures, we and our collaborators have frequently observed two
types of calli, those that produce abundant embryos (embryogenic calli) and those
that produce few if any embryos (non-embryogenic calli) (unpublished observations).
To investigate the relationship between TcLEC2 activity and embryogenic potential
of the calli, TcLEC2 gene expression was compared in embryogenic and non-embryogenic calli growing from
explants cultured on SCG media. The observed average levels of TcLEC2 expression were 20-fold higher in the embryogenic calli compared to the non-embryogenic
calli of the same age (Figure&C), suggesting a tight association between TcLEC2 expression and embryogenic competency. Given the role of AtLEC2 in controlling embryo
development in Arabidopsis, we hypothesized that TcLEC2 may play a similar role in
the control of cacao somatic embryo development.
Overexpression of TcLEC2 significantly increased efficiency of somatic embryogenesis and regeneration of transgenic
The current methods for Agrobacterium-mediated transformation of cacao genotype results in reproducible but very low rates
of transgenic embryo recovery []. We speculate that this is a result of very low co-incidence of stable T-DNA integration
into the cacao genome and the same cells entering the embryogenic pathway. We hypothesized
that overexpression of TcLEC2 might enhance the rate of somatic embryogenesis and thus improve the recovery of
transgenic SEs through increased co-incidence with T-DNA integration events.
To test this, we performed Agrobacterium-mediated transformation experiments on cotyledon explants excised from primary embryos
for co-cultivation with Agrobacterium containing the control vector (pGH00.0126) or the E12Ω::TcLEC2 vector (pGZ12.0108).
Two weeks after co-cultivation, the initial transient expression levels of GFP in
tissues transformed with the control vector were always higher than E12Ω::TcLEC2 (Additional
file ). This may be due to the larger size of the E12Ω::TcLEC2 containing plasmid relative
to the control vector, the inclusion of a repeated promoter element, or the addition
of a third highly expressed transgene. We have observed this phenomenon with other
unrelated plasmids containing transgenes (unpublished data).
Additional file 5. Relative transient GFP expression levels of TcLEC2 transformation in SE compared to
Format: PDF
Size: 64KB This file can be viewed with:
During the subsequent weeks of culture on embryogenesis media, large numbers of non-transgenic
embryos (GFP negative) were observed in all three independent transformation trials
regardless of the presence of the TcLEC2 transgene (Additional file ). There was no consistently significant difference observed between the transformations
of control vector and E12Ω::TcLEC2 in terms of the cumulative non-transgenic embryo
production (Additional file ). To identify stably transformed embryos, GFP fluorescence was observed by stereomicroscopy
as a visualization marker. With the control vector lacked the TcLEC2 transgene, no GFP expressing embryos were observed on over 176 cotyledon explants
cultured in three separate experiments. Surprisingly, the transformation with E12Ω::TcLEC2,
containing theTcLEC2 transgene, resulted in the recovery of over 300 stable transgenic embryos distributed
over the entire surface of the cotyledon explant (Figure&A-B). This result was dramatically higher than the stable transformation results we
have observed over many years, with several different transgenes, where the prior
record for a single transformation (about 200 cotyledon explants) was 8 GFP positive
embryos [-]. Thus, although TcLEC2 did not impact the initial levels of transient transformation
(Additional file ) or embryogenesis frequency of non-transgenic embryos (Additional file ), it greatly increased the frequency of transgenic embryo production, which confirmed
our hypothesis.
Additional file 6. Comparison of average of total number of non-transgenic embryo produced per cotyledonary
explant. Sixteen pieces of cotyeldonary explants were placed on each media plate. Three or
four plates (taken as biological replicates) were used for transient transformation
of control vector or E12Ω::TcLEC2 in each transformation trial (n=3 or 4, mean ± SE).
A. Transformation trial 1 (n=3). B. Transformation trial 2 (n=4). C. Transformation trial 3 (n=4).
Format: PDF
Size: 4.4MB This file can be viewed with:
Effect of stable overexpression of TcLEC2 in cacao secondary somatic embryos. A &B. Secondary embryogenic explants transformed with Agrobacterium, regenerating stable transgenic E12Ω::TcLEC2 embryos were photographed under white
and with GFP imaging optics, respectively. C, D &E. Transgenic somatic embryos expressing E12Ω::TcLEC2. (i) embryo-like structure formed on top of cotyledon (ii) embryo-like structure formed
along embryo axis (iii) callus-like structure formed on top of cotyledon.
Although a large number of transgenic TcLEC2 embryos were obtained, most of them exhibited prominent developmental and morphological
abnormalities (Figure&C, D, and E), and most ceased development at the globular or heart stage and the initiations
of cotyledons were significantly compromised. The few embryos that did develop to
cotyledon stage formed callus on top of the cotyledons (Figure&E) and new embryos were occasionally initiated along the embryo axis (Figure&C and D). The attempts to recover plants from any of these embryos were unsuccessful.
To test the effect of stable overexpression of TcLEC2 transgene on iterative somatic embryogenesis, cotyledons from fully developed mature
transgenic E12Ω::TcLEC2 embryos were excised and cultured for tertiary embryo production
as previously described []. Cotyledon explants from non-transformed PSU-SCA6 SEs were cultured as controls. Remarkably, cotyledon explants from transgenic E12Ω::TcLEC2
lines started to produce tertiary embryos as early as four weeks ACI (Figure&B), compared to six weeks for PSU-SCA6 lines (Figure&A). Additionally, while the majority of tertiary embryo production from PSU-SCA6 lines was completed by 14&weeks ACI, after which very few SEs were produced (Figure&C), explants from transgenic E12Ω::TcLEC2 lines continued to produce large numbers
of embryos until twenty weeks ACI, when the experiment was terminated (Figure&D). In total, within the twenty week period, transgenic E12Ω::TcLEC2 lines produced
about 2.5 times more tertiary embryos per explant (p-value & 0.001) compared to PSU-SCA6 lines (Figure&E).
Overexpression of TcLEC2 increases tertiary somatic embryogenesis efficiency. A. Tertiary PSU-SCA6 culture on hormone free medium at 4&weeks ACI. B. Tertiary stable transgenic E12Ω::TcLEC2 culture on hormone free medium at 4&weeks
ACI. C. Tertiary PSU-SCA6 culture on hormone free medium 20&weeks after culture initiation. D. Tertiary stable transgenic E12Ω::TcLEC2 culture on hormone free medium at 20&weeks
ACI. E. Average number of tertiary embryos produced per explant from PSU-SCA6 and stable transgenic E12Ω::TcLEC2 explants (n = 4, mean ± SE) (Bars = 2&mm).
Overexpression of TcLEC2 altered the expression of genes involved in fatty acid biosynthesis
In addition to its role in initiation of embryogenesis, it has been well documented
in Arabidopsis that AtLEC2 also regulates de novo fatty acid biosynthesis during embryo
development. Evidence includes, but is not limited to, (a) transgenic 35S::AtLEC2
ovules exhibited a mature seed-like fatty acid profile []; (b) ectopic overexpression of AtLEC2 in leaves resulted in accumulation of seed specific lipids and very long chain fatty
acids []; (c) AtLEC2 directly regulates expression of AtWRI1, which is known to play a role in regulation of fatty acid metabolism in developing
embryos []. Since fatty acids, in the form of triacylglycerols (TAGs), are major storage components
of mature cacao seeds, we examined the role of TcLEC2 in control of fatty acid biosynthesis
in cacao immature zygotic embryos (IZEs).
E12Ω::TcLEC2 was transiently overexpressed in IZEs (12&weeks old) in parallel with
the control vector (pGZ00.0126). High transient expression was confirmed by fluorescence
microscopy to detect EGFP on approximately 90% of explants surfaces (Additional file
). Overexpression levels of TcLEC2 in transformed IZEs were further confirmed by qRT-PCR and compared to the basal levels
of TcLEC2 in control vector transformed IZEs (Figure&). Consistent with the observations in attached leaf transient assay (Figure&), the overexpression of TcLEC2 resulted in elevated transcript of TcAGL15 and TcLEC1 in the IZE tissues (Figure&A). Unlike in transiently transformed leaf tissue, induced expression of TcWRI1 was not detected in the transformed IZEs under our qRT-PCR condition (40&cycles)
(Additional file ).
Additional file 7. Overexpression of control vector and E12Ω::TcLEC2 in cacao zygotic embryo transient
assay. Fluorescent micrographs of GFP expression (visualization marker) in leaves were captured
five days after transformation (Bars = 2mm). A & B. IZE transformed with control vector with white light and GFP fluorescence imaging.
C & D. IZE transformed with E12Ω::TcLEC2 with white light and GFP fluorescence imaging.
Format: PDF
Size: 6.9MB This file can be viewed with:
Transient overexpression of E12Ω::TcLEC2 in IZE altered fatty acid compositions and
gene expression. A. Changes of the expression levels of responsive enzymes on the fatty acid biosynthesis
expression levels of genes were normalized relative to that of TcTUB1; (n = 3, mean ± SE) *represents for p-value & 0.05 by t-test. B. Molar percentages of fatty acid compositions in cacao immature zygotic embryos transiently
overexpressing vector control and E12Ω::TcLEC2, (n = 3, mean ± SE).
**represents for p-value & 0.001 by t-test. C. Diagram of proposed model to explain the relationship between gene expression levels
and altered fatty acid compositions. Enzymes are marked in circle. Enzymes that were
regulated by the activity of TcLEC2 are in black, otherwise, in grey. Abbreviation:
ER, e ACP,
CoA, Coenzyme A; FAB2, fatty
Fat, fatty acyl-ACP KAS, 3-ketoacyl-ACP FAD2,
FAD6, oleoyl desaturase on membrane
FAD7/8, linoleoyl desaturase on me PC,
G3P, glycerol-3- LPA, PA, DAG,
TAG, PDAT, phospholipid:diacylglyc DGAT, 1,2-sn-diacylglcyerol
transferase.
Additional file 8. Expression levels of genes that are not significantly affected by transient overexpression
of TcLEC2 in cacao IZE compared to control vector (n=3, mean ± SE, significant levels were determined
by t-test). The gene encoding TcWRI1 was also measured but no expression was detected.
Format: PDF
Size: 55KB This file can be viewed with:
To obtain further insights into TcLEC2 regulatory functions during embryo development,
we identified the most likely orthologs of genes for key enzymes controlling the fatty
acid biosynthesis and production of TAGs in the cocoa genome by homology to Arabidopsis
gene sequences (Figure&C and Additional file ) and compared their expression levels in IZEs tissues overexpressing E12Ω::TcLEC2
and control vector (Figure&A). mRNA levels of TcKASII (Tc09g006480), a condensing enzyme β-ketoacyl-[acyl-carrier-protein] synthase II responsible for
the elongation of C16 to C18 [], was two-fold lower (p-value & 0.05) in the TcLEC2 transformed tissue compared to the controls (Figure&A). In addition, the predicted ortholog of TcFatA (Tc01g022130) and two isoforms of TcFatB (Tc01g022130 and Tc03g015170), two types of acyl-[acyl-carrier-protein] thioesterases that specifically export
C18:1 (FatA) and other saturated fatty acid moieties (FatB) from plastid into cytosol
[], were significantly up-regulated by more than 1.5 fold (p-value & 0.05). Interestingly,
the predicted diacylglycerol acyltransferase 2 (TcDGAT2, Tc01g000140), a key enzyme that catalyzed the last step of TAG assembly through an acyl-CoA dependent
pathway [], was significantly up-regulated by 1.5 fold (p-value & 0.05). No significant differences
in the expression levels of two isoforms of fatty acid desaturase 2 (FAB2, Tc04g017510 and Tc08g012550) were observed (Additional file ).
Additional file 9. List of fatty acid biosynthesis related genes in cacao. The expression of these genes were compared in cacao IZE transiently overexpressing
control vector and E12Ω::TcLEC2.
Format: PDF
Size: 759KB This file can be viewed with:
To determine if these changes in gene expression resulted in altered metabolite profiles,
fatty acid composition was measured by gas chromatograph/mass spectrometry (GC/MS)
in IZEs tissues transformed with both E12Ω::TcLEC2 and control vector. Overexpression
of TcLEC2 resulted in a significant increase of the level of cis-vaccenic acid C18:1n-7 (p-value & 0.001), an isoform of oleic acid (OA), and significantly decreased the
level (p-value & 0.001) of linoleic acid (LA, C18:2n-6) compared to tissues transformed with vector control (Figure&B).
Discussion
TcLEC2 is involved in cacao somatic embryogenesis
Somatic embryogenesis has long been considered a superior propagation system for many
crops [-] because of its inherent high multiplication rate and potential for year round, uniform
disease free plant production. Although theoretically, every somatic plant cell has
the capacity to dedifferentiate and redifferentiate into a whole plant (totipotency),
the competencies of plant cells to enter the somatic embryogenesis developmental pathway
varies dramatically between different tissues, developmental stages, and species.
Accumulated evidence has revealed that the activity of AtLEC2 is highly associated
with embryogenic competency and involves interactions with several other regulatory
factors. Our results are consistent with a role of cacao TcLEC2 in the regulation
of somatic embryogenesis similar to AtLEC2 in Arabidopsis. Supporti
(1) ectopic overexpression of TcLEC2 in cacao stage C leaves was able to induce the expression of seed transcription factor
genes, such as TcAGL15, TcABI3 and TcLEC1; (2) the induced expression level of TcLEC2 was associated with embryogenic
(3) constitutive overexpression
of TcLEC2 in secondary somatic embryo tissue leads to earlier and increased regeneration of
tertiary embryos compared to PSU-SCA6 controls. Collectively, our evidence supports the conclusion that TcLEC2 is a functional
ortholog of AtLEC2 and that it is involved in similar genetic regulatory networks
during cacao somatic embryogenesis.
Transient overexpression of TcLEC2 in cotyledon explants by itself was not sufficient to increase embryogenesis efficiency
of non-transgenic somatic embryos (Additional file ). This suggests that there are other factor (s) that are required for cell dedifferentiation
and redifferentiation, which are not present during the period of time examined in
our embryogenesis culture system. However, the constitutive overexpression of TcLEC2 in stably transformed cells resulted in greatly enhanced somatic embryogenesis as
early as four weeks compared to six to seven without TcLEC2 overexpression (Figures&B, B and E), implying that the enhanced activity of TcLEC2 is sufficient to promote the
efficiency of somatic embryogenesis in cacao.
The very high degree of genotype variation in embryogenic capacity for SE in cacao
limits its’ practical application for large scale propagation []. Therefore, TcLEC2 could be a useful molecular marker for screening cacao genotypes for high embryogenic
capacities. Additionally, the levels of TcLEC2 expression in callus and other tissues in vitro could be used for evaluating the effect of different media and other variables for
further optimization of the SE protocols. Potentially, we could explore the possibility
to promote somatic embryogenesis in cacao leaves or other tissues by ectopically expressing
TcLEC2 regulates fatty acid biosynthesis during cacao seed maturation
Fatty acid composition and lipid profiles of cacao seeds are important quality traits
for chocolate industry. Therefore, there is great interest in identification of the
genetic networks regulating its biosynthesis. LEC2, and its partners LEC1, ABI3 and
FUS3 are known to be critical regulators of fatty acid and lipid biosynthesis in Arabidopsis
and other species, and thus impact many aspects of seed development. Moreover, of
particular relevance to applications of this knowledge, the level of WRI1, a downstream
target of LEC1, LEC2 and FUS3, was highly correlated with seed oil content in different
B. napus genotypes []. Our observations that TcLEC2 overexpression resulted in increased expression of TcLEC1 and TcWRI1 (Figure&) in attached cacao leaves promoted us to speculated that this might result in changes
in fatty acid composition and TAG assembly. Indeed, transient overexpression of TcLEC2 in zygotic embryos resulted in increased C18:1n-7 and decreased C18:2n-6 levels (Figure&B), similar to changes occurring during cacao seed maturation when profiles change
from mainly polyunsaturated fatty acids (C18:2n-6 and C18:3n-3) to almost exclusively saturated (C16:0 and C18:0) and monounsaturated fatty acid
(C18:1n-9) []. However, given the fact that the expression of TcWRI1 was not induced by overexpression of TcLEC2 in immature zygotic embryos, it suggests that WRI1 is not required to mediated impacts
of TcLEC2 on fatty acid biosynthesis, and that the regulatory network between TcLEC2
and other transcription factors on fatty acid biosynthesis is not the same in cacao
as they are in Arabidopsis and B. napus. The overexpression of TcLEC2 also resulted in changes in gene expression for some of the major structural genes
for fatty acid biosynthesis, and this could provide an explanation for the fatty acid
composition shifts we observed. C18:1n-7 is synthesized from C16:0 via the production of C16:1n-9 by FAB2 and further elongation to C18:1n-7 []. The decreased expression level of TcKASII may increase the substrate availability of C16:0, which could serve as a substrate
for TcFAB2 for the production of C16:1n-9 and further leading to C18:1n-7 accumulation (Figure&C). The increased levels of TcFatA and two isoforms of TcFatB (all significantly up-regulated by more than 1.5 fold) could contribute to increased
production and accumulation of saturated fatty acid (C16:0 and C18:0) and monounsaturated
fatty acid (C18:1n-9) during cacao seed maturation (Figure&C).
Interestingly, the expression of TcDGAT2 was also significantly increased by overexpression of TcLEC2, but the expression level of TcDGAT1.1 was not affected (Additional file ). The activities of DGAT genes were highly correlated with the oil content and compositions
in oilseeds [] and three known types of DGAT genes (DGAT1, DGAT2 and DGAT3) are different in terms
of substrate specificities and subcellular localizations []. According to an unpublished study, the expression of TcDGAT2 in yeast has led to accumulation of more C18:0 in TAG fraction compared to the expression
of TcDGAT1 []. Considering the fact that the majority of TAGs in cacao mature seeds consist of
unsaturated fatty acid (C18:1) exclusively on sn-2 and saturated fatty acids (C16:0
and C18:0) on sn-1 and 3 (Figure&C), it is plausible to speculate, that the activity of TcDGAT2 is more significant
to catalyze the final acylation on sn-3 of TAG assembly compared to TcDGAT1. This
argument was further supported by our result indicating that the expression level
of TcDGAT2 was approximately five times higher than TcDGAT1 in cacao immature seeds (Figure&A and Additional file ). Collectively, our data indicates that TcLEC2 could be involved in regulation of
lipid biosynthesis during cacao seed maturation through control of TcDGAT2 gene expression. However, whether TcLEC2 is able to directly trans-activate TcDGAT2 or its action is mediated through other transcription factors, remains unknown. Further
research on the regulatory mechanism controlling fatty acid biosynthesis and TAG assembly
in cacao will contribute to identification of the key enzymes in the pathway and aid
the screening process for elite cacao varieties to meet industrial demands.
Conclusion
The isolation and functional characterization of LEC2 ortholog from cacao genome reveal crucial roles of TcLEC2 in regulating both zygotic
and somatic embryogenesis. The exclusive expression pattern in seed and the identification
of its regulatory targets, such as AGL15 and WRI1, strongly indicate the functional similarities between AtLEC2 and TcLEC2. However,
the impacts of TcLEC2 on fatty acid biosynthesis in cacao also suggest that TcLEC2
is able to direct or indirectly interact with many key enzymes on the pathway, which
has not been well characterized yet in Arabidopsis. Furthermore, the correlation between
the activity of TcLEC2 and embryogenic potential during cacao somatic embryogenesis
provides us a great opportunity to better understand and improve our current inefficient
and variable propagation system of cacao.
Phylogenetic analysis and sequence alignment
B3 domain containing genes in Theobroma cacao were identified by blastp using AtLEC2 (At1g28300) as queries (E-value cut off 1e-5). Multiple protein sequence alignment was performed by MUSCLE []. The phylogenetic tree was constructed by MEGA4.1 using neighbor-joining algorithm
with Poisson correction model and the option of pairwise deletion []. Bootstrap values represent 1000 replicates. Full-length Arabidopsis AtLEC2, AtABI3, and AtFUS3, protein sequences were used to search the Cocoa Genome Database ( ) by tblastn [] to obtain the full-length TcLEC2, TcABI3 and TcFUS3 nucleotide sequences, respectively. The functional B3 domains were predicted using
InterPro program ( ) on EMBL-EBI website. B3 domain containing proteins from five subfamilies in Arabidopsis were identified and selected according to [].
RNA extraction, TcLEC2 cloning and expression vector construction
Plant tissues collected from SCA6 genotype of cacao were first ground in liquid nitrogen.
Total RNA was extracted using Plant RNA Purification Reagent (Life Technologies, Cat.
1, following manufactures protocol). The concentration of RNA was measured
using a Nanodrop 2000c (Thermo Scientific). RNA was further treated with RQ1 RNase-free
DNase (Promega, Cat. M6101) to remove potential genomic DNA contamination (following
the manufacturer’s protocol). 250&ng of treated RNA was reverse-transcribed by M-MuLV
Reverse Transcriptase (New England Biolabs) with oligo-(dT)15 primers. The full length
TcLEC2 was amplified from SCA6 mature seed cotyledon cDNA with the primer pair (TcLEC2-5′-SpeI: GCACTAGTATGGAAAACTCTTACACACC and TcLEC2-3′-HpaI: GCGTTAACTCAAAGTGAAAAATTGTAGTGATTGAC) and cloned into pGH00.0126 [] driven by the E12-Ω promoter resulting in plasmid pGZ12.0108 (Additional file ). The recombinant binary plasmid was introduced into A. tumefaciens strain AGL1 [] by electroporation.
TcLEC2 expression analysis by qRT-PCR
RNA samples were extracted and reverse-transcribed into cDNA as described above. The
primers to detect TcLEC2 transcripts were designed based on the coding sequence of TcLEC2 (Tc06g015590 []) (TcLEC2-Realtime-5′: TGACCAGCTCTGGTGCTGACAATA; TcLEC2-Realtime-3′: TGATGTTGGGTCCCTTGGGAGAAT). qRT-PCR was performed in a 10&μl mixture containing 4&μl
diluted-cDNA (1:50), 5&μl SYBR Green PCR Master Mix (Takara), 0.2&μl Rox, and 0.4&μl
each 5&μM primers. Each reaction was performed in duplicates in Roche Applied Biosystem
StepOne Plus Realtime PCR System under the following program: 15&min at 94°C, 40&cycle
of 15&s at 94°C, 20s at 60°C, and 40&s at 72°C. The specificity of the primer pair
was examined by PCR visualized on a 2% agarose Gel and dissociation curve. An acyl
carrier protein (Tc01g039970, TcACP1 []&TcACP1-5′: GGAAAGCAAGGGTGTCTCGTTGAA and TcACP1-3′: GCGAGTTGAAATCTGCTGTTGTTTGG), and a tubulin gene in cacao (Tc06g000360, TcTUB1 []&TcTUB1-5′: GGAGGAGTCTCTATAAGCTTGCAGTTGG and TcTUB1-3′: ACATAAGCATAGCCAGCTAGAGCCAG) were used as the reference genes.
Cacao attached leaf and immature zygotic embryo transient gene expression assay
A. tumefaciens strain AGL1 carrying either control vector (pGH00.0126, GenBank Accession: KF018690, EGFP only)
or E12Ω::TcLEC2 (pGZ12.0108, GenBank Accession: KF963132, Additional file ) were inoculated in 100&ml 523 medium with 50&μg/ml kanamycin and grown with shaking
(200&rpm, 25°C) overnight to optical density (O.D.) of 1.0 at 420&nm. AGL1 was pelleted at 1500xg for 17&min at room temperature and resuspended in induction
media [] to to O.D. of 1.0 at 420&nm. AGL1 was induced for 3&h at 100&rpm at 25°C and Silwet added to a final concentration
of 0.02%. For the attached leaf transient transformation assay we used fully expanded,
young leaves (developmental stage C as defined in []) from genotype SCA6 grown in a greenhouse. The petioles of the leaves were wrapped with parafilm and
set in the groove of a modified vacuum desiccator to create a seal and to avoid damage
to leaves. The leaves were soaked in AGL1 induction media in the desiccator and were
vacuum infiltrated at -22&psi for 2&min using a vacuum pump (GAST Model No. 0523-V4F-G582DX).
Vacuum infiltration was performed three times to increase transformation efficiency.
The transformed cacao leaves remained on the plant for three days after infiltration
then collected and evaluated by fluorescence microscopy. The regions with high GFP
expression (&80% coverage) were selected and subjected to further analysis. For immature
zygotic embryo transient transformation assay, developing fruit (open pollinated Sca6, four months after pollination) from the USDA germplasm collection in Puerto Rico.
Zygotic embryo cotyledons were collected and suspended in the ED media [] before transformation. Zygotic cotyledons were soaked in AGL1 induction media and
transformation was performed as described above for leaf transient expression assays.
The transformed tissues were analyzed five days after infiltration.
Cacao stable transformation of primary somatic embryos
Primary somatic embryogenesis was performed as previously described []. Glossy cotyledons from healthy and mature primary embryos were cut into 4&mm X 4&mm
square pieces, and infected using A. tumefaciens strain AGL1 carrying the T-DNA binary vectors as previously described [] with minor modifications: (1) the AGL1 was pelleted and resuspended in induction
media [] to reach the O.D. of 1.0 at 420&nm instead of 0.5; (2) after transformation, the
infected cotyledons were co-cultivated with A. tumefaciens strain AGL1 on the filter paper for 72&h at 25°C in the dark instead of 48&h. The
transformed explants were cultivated and transgenic secondary somatic embryos were
identified by screening for GFP fluorescence as previously described [].
Fatty acid profiling by GC/MS
Fresh plant tissues were ground in liquid nitrogen and fatty acid methyl esters (FAME)
were prepared using approximately 30&mg of tissue extracted in 1&ml buffer containing
MeOH/fuming HCl/Dichloromethane (10:1:1, v/v) while incubated without shaking at 80°C
for 2&h. Fatty acid methyl esters were re-extracted in 1&ml buffer H2O/Hexane/Dichloromethane
(5:4:1, v/v) with vortexing for 1&min. The hexane (upper phase) was separated by centrifugation
at 1500xg for 5&min, transferred to Agilent glass GC vials and evaporated to dryness
under a vacuum. The FAMEs were then dissolved in 500&μl hexane for GC/MS analysis.
Pentadecanoic acid (C15:0) (Sigma, Cat. P6125) was used as the internal standard added
prior to the extraction and methyl nonadecanoate (C19:0-methyl ester) (Sigma, Cat.
N5377) was used as the spike control, added into the sample prior to the GC injection.
Fatty acid derivatives were analyzed on an Agilent 6890 Gas Chromatograph equipped
with FAME Mix Omegawax 250 Capillary GC column (Sigma, Cat. 24136). A Waters GCT Classic
mass spectrometry was directly connected to the GC operation. EI of 70&eV was applied.
Peak height areas were used to quantify the abundance of each fatty acid species,
and the mass spectra were interpreted by comparing with the NIST/EPA/NIH Mass Spectra
Library [].
Accession numbers
Sequence data from this article can be found in either The Arabidopsis Information
Resource (TAIR) or CocoaGenDB ( ) under the following accession numbers in Table&.
Accession numbers of tested genes in our study
Abbreviations
SCA6: Scavana 6; LEC: L ABI3: ABA INSENSITIVE 3; FUS3: FUSCA3; SE:
S ZE: Z WRI1: WRINKLED 1; AGL15: AGAMOUS-like
15; OLE: OLEOSIN; YUC: YUCCA; ARF: A HSI: High level expression
RAV: Related to ABI3/VP1; REM: R TUB1: T
ACP1: A 2, 4D: 2, 4-Dichlo SCG: Secondary
embryogen ACI: Afte IZE: Immature zygotic
TAG: T GC/MS: Gas chromatograph/ OA: Oleic
LA: L ER: E CoA: Coenzyme A; FAB2: Fatty acid
Fat: Fatty acyl-ACP KAS: 3-ketoacyl-ACP FAD2:
O FAD3: L FAD6: Oleoyl desaturase on membrane
FAD7/8: Linoleoyl desaturase on me PC: P
G3P: Glycerol-3- LPA: L PA: P DAG: D
TAG: T PDAT: Phospholipid:diacylglyc DGAT: 1,
2-sn-diacylglcyerol transferase.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
YZ performed most of the experiments, such as phylogenetic analysis, gene expression
analysis, transient and stable transformation assays, FAME analysis, and drafted the
manuscript. AC participated in the vector construction, gene expression analysis,
somatic embryogenesis transformation, and review the manuscript. SNM involved in designing
and directing the experiments, and revising the manuscript. MJG conceived the study,
gave advice on experiments, drafted and finalized the manuscript. All authors read
and approved the final manuscript.
Acknowledgements
We would like to thank Dr. Phillip Smith from Proteomics and Mass Spectrometry Core
Facility for the great help with GC analysis, Lena Landherr and Sharon Pishak for
the technical assistance in maintenance of our cacao tissue culture pipeline. We are
also grateful to Andrew Fisher for valuable comments to improve the manuscript. We
thank Brian Irish of the USDA ARS located in Mayaguez, Puerto Rico, for provision
of cacao pods. This work was supported in part by The Pennsylvania State University,
College of Agricultural Sciences, The Huck Institutes of Life Sciences, the American
Research Institute Penn State Endowed Program in the Molecular Biology of Cacao and
a grant from the National Science Foundation BREAD program in cooperation with the
Bill and Melinda Gates Foundation (NSF0965353) which supported the development of
the transient gene expression assay for cacao.
References
Anonymous: Cocoa Market Update: World Cocoa Foundation. 2012.
Irizarry H,
Goenaga R:
Clonal selection in cacao based on early yield performance of grafted trees. J Agric Univ PR 2000,
8(3–4):153-163.
Irizarry H,
Early yield of five cacao families at three locations in Puerto Rico. J Agric Univ PR 1999,
82(3–4):167-176.
Cheesman EE,
Uniformity trials on cacao. Trop Agric 1932,
IX(9):277-287.
Maximova SN,
Alemanno L,
Ferriere N,
Guiltinan MJ:
Efficiency, genotypic variability, and cellular origin of primary and secondary somatic
embryogenesis of Theobroma cacao L. In Vitro Cell Dev Plant 2002,
38(3):252-259.
Hasegawa PM,
Asexual embryogenesis in Theobroma-cacao L. J Am Soc Hortic Sci 1979,
104(2):145-148.
Lopez Baez O,
Petiard V:
Somatic embryogenesis and plant-regeneration from flower parts of cocoa Theobroma-cacao
L. Cr Acad Sci Iii-Vie 1993,
316(6):579-584.
Maximova S,
Guiltinan MJ:
Somatic embryogenesis and plant regeneration from floral explants of cacao (Theobroma
cacao L.) using thidiazuron. In Vitro Cell Dev Plant 1998,
34(4):293-299.
Yamagishi K,
Fischer RL,
Goldberg RB,
Harada JJ:
Arabidopsis LEAFY COTYLEDON1 is sufficient to induce embryo development in vegetative
cells. Cell 1998,
Pelletier J,
Lepiniec L,
Fischer RL,
Goldberg RB,
Harada JJ:
LEAFY COTYLEDON2 encodes a B3 domain transcription factor that induces embryo development. Proc Natl Acad Sci U S A 2001,
Luerssen H,
Herrmann P,
FUSCA3 encodes a protein with a conserved VP1/AB13-like B3 domain which is of functional
importance for the regulation of seed maturation in Arabidopsis thaliana. Plant J 1998,
15(6):755-764.
Braybrook SA,
Harada JJ:
LECs go crazy in embryo development. Trends Plant Sci 2008,
13(12):624-630.
Braybrook SA,
Fischer RL,
Goldberg RB,
Harada JJ:
Genes directly regulated by LEAFY COTYLEDON2 provide insight into the control of embryo
maturation and somatic embryogenesis. Proc Natl Acad Sci U S A 2006,
LEAFY COTYLEDON2 gene expression and auxin treatment in relation to embryogenic capacity
of Arabidopsis somatic cells. Plant Cell Rep 2009,
Frigerio L,
Menassa R:
Following vegetative to embryonic cellular changes in leaves of Arabidopsis overexpressing
LEAFY COTYLEDON2. Plant Physiol 2013,
Santos Mendoza M,
Dubreucq B,
Caboche M,
Lepiniec L:
LEAFY COTYLEDON 2 activation is sufficient to trigger the accumulation of oil and
seed specific mRNAs in Arabidopsis leaves. FEBS Lett 2005,
Mendoza MS,
Harscoet E,
Lepiniec L,
Dubreucq B:
WRINKLED1 specifies the regulatory action of LEAFY COTYLEDON2 towards fatty acid metabolism
during seed maturation in Arabidopsis. Plant J 2007,
50(5):825-838.
Harada JJ,
Lemaux PG:
Leafy cotyledon genes are essential for induction of somatic embryogenesis of Arabidopsis. Planta 2005,
222(6):977-988.
Induced expression of AtLEC1 and AtLEC2 differentially promotes somatic embryogenesis
in transgenic tobacco plants. PLoS One 2013,
8(8):e71714.
doi: 10.1371/journal.pone.0071714
Marker-free transformation: increasing transformation frequency by the use of regeneration-promoting
genes. Curr Opin Biotechnol 2002,
13(2):173-180.
Fujimura T,
Komamine A:
Involvement of endogenous auxin in somatic embryogenesis in a carrot cell-suspension
culture. Z Pflanzenphysiol 1979,
95(1):13-19.
Matsuta N:
Effect of auxin on somatic embryogenesis from leaf callus in Grape (Vitis-Spp). Jpn J Breed 1992,
42(4):879-883.
Qureshi JA,
Saxena PK:
Morphoregulatory role of thidiazuron - substitution of auxin and cytokinin requirement
for the induction of somatic embryogenesis in geranium hypocotyl cultures. Plant Physiol 1992,
Braybrook SA,
Pelletier J,
Fischer RL,
Goldberg RB,
Harada JJ:
Arabidopsis LEAFY COTYLEDON2 induces maturation traits and auxin activity: Implications
for somatic embryogenesis. Proc Natl Acad Sci U S A 2008,
Wojcikowska B,
Jaskola K,
Gasiorek P,
LEAFY COTYLEDON2 (LEC2) promotes embryogenic induction in somatic tissues of Arabidopsis,
via YUCCA-mediated auxin biosynthesis. Planta 2013,
238(3):425-440.
Aghavaisi B,
Mahmoudi Pour A:
Molecular aspects of somatic-to-embryogenic transition in plants. J Chem Biol 2009,
2(4):177-190.
Glassman K,
Tarczynski MC:
Expression of ZmLEC1 and ZmWRI1 increases seed oil production in maize. Plant Physiol 2010,
153(3):980-987.
Enhanced seed oil production in canola by conditional expression of Brassica napus
LEAFY COTYLEDON1 and LEC1-LIKE in developing seeds. Plant Physiol 2011,
Tsukagoshi H,
Ishiguro S,
Nakamura K:
An AP2-type transcription factor, WRINKLED1, of Arabidopsis thaliana binds to the
AW-box sequence conserved among proximal upstream regions of genes involved in fatty
acid synthesis. Plant J 2009,
60(3):476-487.
Sreenivasulu N,
Seed-development programs: a systems biology-based comparison between dicots and monocots. Annu Rev Plant Biol 2013,
64:189-217.
Romanel EA,
Schrago CG,
Counago RM,
Alves-Ferreira M:
Evolution of the B3 DNA binding superfamily: new insights into REM family gene diversification. PLoS One 2009,
4(6):e5791.
Guiltinan MJ,
Allegre M,
Chaparro C,
Legavre T,
Maximova SN,
Poulain J,
The genome of Theobroma cacao. Nat Genet 2011,
43(2):101-108.
Altschul SF,
Lipman DJ:
Basic local alignment search tool. J Mol Biol 1990,
215(3):403-410.
Motamayor JC,
Mockaitis K,
Schmutz J,
Haiminen N,
Livingstone D 3rd,
Cornejo O,
Findley SD,
Royaert S,
Jenkins J,
Podicheti R,
Scheffler B:
The genome sequence of the most widely cultivated cacao type and its use to identify
candidate genes regulating pod color. Genome Biol 2013,
14(6):R53.
Guiltinan MJ,
Landherr L,
Maximova SN:
Expression of designed antimicrobial peptides in Theobroma cacao L. Trees reduces
leaf necrosis caused by Phytophthora spp. Acs Sym Ser 2012,
1095:379-395.
Shanklin J,
Furtek DB:
Changes in fatty-acid composition and stearoyl-acyl carrier protein desaturase expression
in developing Theobroma-cacao L embryos. Planta 1994,
193(1):83-88.
Gutierrez-Marcos JF,
Dickinson HG:
More than a yolk: the short life and complex times of the plant endosperm. Trends Plant Sci 2004,
9(10):507-514.
Maximova S,
Guiltinan MJ:
TcNPR3 from Theobroma cacao functions as a repressor of the pathogen defense response. BMC Plant Biol 2013,
Harding EW,
Nichols KW,
Fernandez DE,
Expression and maintenance of embryogenic potential is enhanced through constitutive
expression of AGAMOUS-Like 15. Plant Physiol 2003,
133(2):653-663.
Stromberg AJ,
Global Identification of targets of the Arabidopsis MADS domain protein AGAMOUS-Like15. Plant Cell 2009,
Nambara E,
Mccourt P:
A mutant of arabidopsis which is defective in seed development and storage protein
accumulation is a new ABI3 allele. Plant J 1992,
2(4):435-441.
Seifert M,
Keilwagen J,
Weisshaar B,
Baumlein H,
Altschmied L:
Toward the identification and regulation of the Arabidopsis thaliana ABI3 regulon. Nucleic Acids Res 2012,
Moreno-Risueno M?,
González N,
Carbonero P,
Vicente-Carbajosa J:
FUSCA3 from barley unveils a common transcriptional regulation of seed-specific genes
between cereals and Arabidopsis. Plant J 2008,
53(6):882-894.
Yamamoto-Toyoda A,
Tsutsumida K,
Sakakibara H,
Hattori T:
The mechanism of the regulation of seed maturation by the FUS3 transcription factor
revealed by transcriptome analysis. Plant Cell Physiol 2007,
48:S190-S190.
Efficient regeneration potential is closely related to auxin exposure time and catalase
metabolism during the somatic embryogenesis of immature embryos in Triticum aestivum
L. Mol Biotechnol 2013,
54(2):451-460.
Delporte F,
Muhovski Y,
Pretova A,
Watillon B:
Analysis of expression profiles of selected genes associated with the regenerative
property and the receptivity to gene transfer during somatic embryogenesis in Triticum
aestivum L. Mol Biol Rep 2013,
Maximova S,
Antunez de Mayolo G,
Guiltinan MJ:
Stable transformation of Theobroma cacao L. and influence of matrix attachment regions
on GFP expression. Plant Cell Rep 2003,
21(9):872-883.
Guiltinan M,
Landherr L,
Maximova S:
Expression of Designed Antimicrobial Peptides in Theobroma Cacao L. Trees Reduces Leaf Necrosis Caused by Phytophthora spp. In Acs Sym Ser.
Volume 1095.
American Chemical S
2012::379-395.
Maximova SN,
Marelli JP,
Verica JA,
Guiltinan MJ:
Over-expression of a cacao class I chitinase gene in Theobroma cacao L. enhances resistance
against the pathogen, Colletotrichum gloeosporioides. Planta 2006,
224:740-749.
Arabidopsis β-ketoacyl-[acyl carrier protein] synthase I is crucial for fatty acid
synthesis and plays a role in chloroplast division and embryo development. Plant Cell Online 2010,
Moreno-Perez AJ,
Venegas-Caleron M,
Vaistij FE,
Larson TR,
Graham IA,
Martinez-Force E:
Reduced expression of FatA thioesterases in Arabidopsis affects the oil content and
fatty acid composition of the seeds. Planta 2012,
235(3):629-639.
Weselake RJ:
Diacylglycerol acyltransferase: a key mediator of plant triacylglycerol synthesis. Lipids 2006,
Barry-Etienne D,
Bertrand B,
Vasquez N,
Etienne H:
Comparison of somatic embryogenesis-derived coffee (Coffea arabica L.) plantlets regenerated
in vitro or ex vitro: morphological, mineral and water characteristics. Ann Bot 2002,
90(1):77-85.
Nishizawa K,
Takahashi M,
Kitayama M,
Ishimoto M:
Genetic improvement of the somatic embryogenesis and regeneration in soybean and transformation
of the improved breeding lines. Plant Cell Rep 2007,
26(4):439-447.
Baluska F,
Pretova A,
Volkmann D:
Auxin deprivation induces a developmental switch in maize somatic embryogenesis involving
redistribution of microtubules and actin filaments from endoplasmic to cortical cytoskeletal
arrays. Plant Cell Rep 2003,
21(10):940-945.
Barthet VJ:
(n-7) and (n-9) cis-Monounsaturated fatty acid contents of 12 Brassica species. Phytochemistry 2008,
69(2):411-417.
Roesler K,
Williams ME,
Glassman K,
Solawetz W,
Bhattramakki D,
Deschamps S,
Tarczynski M,
A phenylalanine in DGAT is a key determinant of oil content and composition in maize. Nat Genet 2008,
40(3):367-372.
Shockey JM,
Chapital DC,
Dhanoa PK,
Rothstein SJ,
Mullen RT,
Tung tree DGAT1 and DGAT2 have nonredundant functions in triacylglycerol biosynthesis
and are localized to different subdomains of the endoplasmic reticulum. Plant Cell 2006,
Zhang Y: Recombinant expression of plant diacylglycerol acyltransferases from tissues that
accumulate saturated fatty acids.
Edmonton, Alberta: University of A
MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 2004,
MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007,
Ludwig RA:
A DNA transformation-competent Arabidopsis genomic library in Agrobacterium. Biotechnology (N Y) 1991,
9(10):963-967.
Maximova SN,
Dandekar AM,
Guiltinan MJ:
Investigation of Agrobacterium-mediated transformation of apple using green fluorescent
protein: high transient expression and low stable transformation suggest that factors
other than T-DNA transfer are rate-limiting. Plant Mol Biol 1998,
37(3):549-559.
Maximova SN,
Guiltinan MJ:
Functional analysis of the Theobroma cacao NPR1 gene in Arabidopsis. BMC Plant Biol 2010,
Estimating probabilities of correct identification from results of mass spectral library
searches. Proc Natl Acad Sci U S A 1997,
5(4):316-323.
Sign up to receive new article alerts from BMC Plant Biology